overtime

I was standing behind the counter, idly staring at my phone, as was longstanding tradition during downtime. The evening rush had just passed, which meant I would get the next few hours more or less to myself – peppered, of course, with a few visits from teenagers to loiter and buy energy drinks. Currently, two girls were spending far too much time deliberating over which oddly shaped health drink to buy. The forums were moving slowly tonight, and I was already bored. Not quite bored enough to mop the floor or clean out the soda machine, but bored enough to watch customers. My focus lazily shifted between the phone’s screen and the brightly dressed duo. I remained by the register, manning my station, the steadfast defender of the convenience store.

The umpteenth time I glanced towards the girls, I saw it. A large, shambling, black mass coming through the sliding glass doors on the opposite side of the store. I blinked twice and focused on it for a moment, not believing my eyes. As it approached, the horrifying realization set in, and my heart froze. I was looking at a bear. An adult black bear.

eat your greens

Like any sane, rational human being, my first response was to release a terrified, high-pitched screech. The girls immediately winced and looked about, confused by my outburst. The bear’s ears perked up, and it looked directly at me. My eyes locked with the beast, and the both of us stood still for a moment, assessing each other. I saw a thin, worn collar around its neck, possibly with a tag of some sort. The girls were watching my face and curiously looking at the doors, wondering what had caught my attention. Ignorance is bliss.

A hundred panicked thoughts raced through my head. Am I going to die? What about those girls? Why is it here? Do I try to make a run for the exit? The window? What would my friends think of me, mauled to death at my lame-ass corner store job? Should I call someone? Who would I even call about a goddamn bear?!

Either way, my new friend was convinced I wasn’t a threat for the moment, and so he casually waddled towards the pastry case beside the entrance, shifted onto his hind legs, and begun pawing at the glass. The girls, upon seeing the beast over the aisles, both mirrored my reaction – the bear, however, didn’t seem as interested in their shrieks. Maybe I’ve just got more talent.

Surprisingly, my shaking hands managed to find the phone lying on the counter, hit the call button, and numbly tap out 9-1-1. A calm, disinterested male voice answered within seconds. I spoke as softly as I could.

“911, what is your emergency?”

“My name is ¹®$¿—(Šìqå¤. I work at a convenience store located on 2311 Hendern Street, in Rockford. This is gonna sound crazy, I know this is uh… This is very unlikely, but there’s a black bear in my store.”

“A bear, you said?”

“Yes! A bear!”

“…Sir, this is Illinois. There are no bears.”

“I know! I know it sounds insane! Please, just send someone, do something, it’s looking right at me!”

“…And in fact, according to our map, your store is in the middle of a dense metropolitan area.”

“Please, this isn’t a trick or a prank or whatever, please just send someone to this location, I’m trapped!”

“Alright, sir. I’ll try to get some help out to your location. Stay calm, and hold tight.”

“Thank you, thank you! Please hurry!”

During my short conversation with the operator, my new friend had managed to smash open the pastry case, and was now sloppily, noisily enjoying his fill of stale donuts. The girls were whispering to each other, and slowly inching towards the exit. I was impressed by their boldness. Unfortunately, I had no such avenue of escape.

I watched as the two delicately tiptoed closer to the exit, aisle by aisle. There was only a small 3 foot clearance between the doors and where the animal stood, and so it seemed to be a fairly risky move. When they neared the door, my fears were realized. As soon as the first girl triggered the door’s opening sensor, the bear whipped its head backward, and immediately disengaged from its meal. In response, she panicked for a moment – just long enough to get brutally swatted down by the beast, punctuated with a gut-wrenching roar. The giant paw connected with the side of her stomach, and she went down instantly, effortlessly. She crumpled to the floor like a rag doll, as if the bear’s touch had paralyzed her. Her friend, evidently a prudent opportunist, sprinted out of the now open door and into the night, screaming.

perceptual-bison

The girl laid on the floor, quiet and motionless. I didn’t know if she was still alive. The bear appeared to lick her midsection a few times and sniff her a bit before returning to the pastry case, as if nothing had ever happened. It continued to rummage through the store’s fine selections, and eventually became enamored with the chip section. He remained there for several minutes, leaving a clear path to the sliding doors. I realized I had an opportunity to escape – although the girl was caught, I may not be.

I slowly, hesitantly climbed over the counter and moved forward. The store was now quite disheveled, and smelled much like a zoo. As I got closer to the fallen girl, I realized just how severe her injuries really were – I had no idea people actually bled that much. I didn’t get the opportunity to more closely examine her however, because I soon found myself nearly face-to-face with the bear, it having seemingly teleported in front of the door, emitting a vicious, enraged snarl. I was completely shocked – I could have sworn it was several aisles away, calm, and completely stationary a few seconds ago.

I backed away, and slowly, hesitantly, climbed back over the counter. Easily. Calmly. Just like the first time. It seemed like my new friend didn’t want me to leave. I watched the bear intently for the next half-hour – he thoroughly worked over the entire store, tearing apart and eating as much as he could.

I was alone – still no customers, still no police. I was determined to escape, but every time I attempted to climb over again, he’d release an angry roar, or move to preemptively intercept me, keeping me contained. In fact, he seemed agitated if I were anywhere else but in that exact corner, behind the counter. I was overcome with anxiety; where was my help? Was my call even taken seriously?

Finally, the bear stopped his feast. He was now in front of the packaged fruit pies, the only snack item he hadn’t touched. We had a very large selection, spanning many brands and flavors – don’t ask me why. I first assumed the animal’s attention was simply caught by the vibrant colors and variety, but what he did next I wouldn’t have ever guessed. He carefully picked one up by the end with his teeth, and to my horror, began lumbering towards me. In a panic, I crouched behind the counter. I didn’t know what I had hoped to accomplish in doing so – he walked right around and straight up to me, then stopped. He was so close to me, I knew jumping over the counter and going for the door wouldn’t be an option. For the first time, I looked my captor in the eye, face-to-face. This close, I could now read the tag on his faded red collar – it simply said “BORRIS”, engraved in large, cartoonish letters on a fake golden doubloon.

Borris carefully dropped the pie at my feet, and favored me with an expression I could almost describe as “amused”. I stood perfectly still. He inched the pie closer to me with his snout, sporting the same dumb, silly expression. I remained still. Borris emitted a low growl, and inched the pie ever closer to me.

show tell

Experiencing the deepest fear I’ve ever felt, I slowly extended my hand outward, and picked the pie up. Borris was still watching me intently, his eyes reflecting an innocent, benign disposition that I knew to be a nasty ruse. I began to eat the pie, which seemed to please him. As soon as I had finished, he immediately went and retrieved another. And another. And yet another still. It became a routine. I came to be a bit relaxed and amused, given the circumstances. Someone would likely be there soon to help me, and in the meantime, I just needed to entertain this big, dumb animal. The situation, I had to admit, seemed quite funny.

By the time an hour had passed however, my joviality was waning. I had angrily accepted at this point that the police weren’t coming – I was equally exasperated by the lack of new customers, and the lack of the one escapee bringing back help. None of my friends had answered my phone calls, either. Borris, I’d learned, was quite adept at detecting my sleights of hand, and no matter what I tried – eating very slowly, pretending to eat, throwing the pie back, or even destroying it – he’d always have me eat the pie, or punish me for disposing of it. My left leg had a deep laceration from what I had deemed my final attempt at subterfuge – I had crushed the pie right in front of him, which prompted him to immediately, angrily dig his claw into my leg. I’d taken my shirt off and tied it around the trunk of my thigh, effectively stopping most of the bleeding, but I definitely wasn’t going anywhere at this point.

Time passed slowly. Each agonizing minute, my stomach protested my actions, and my leg ached. I was sure I had no room left in my stomach, and yet I continued to eat. I was sure there were no pies even left in the store, even with our impressive stock, and yet Borris continued to come back with more. My breath was getting shorter, and every new bite felt like I was further overfilling a water balloon already threatening to burst. My belly was becoming painfully distended. The smell of that horrible artificial cherry flavoring was nauseating, and it dominated my thoughts. Despite all this, an odd sort of calm was washing over me; I wasn’t sure if I was experiencing a sugar coma, the “acceptance” stage of loss, or Stockholm syndrome. I’d lost count of the precise number somewhere around 50 pies. It was clear I was reaching the point where my body needed this to stop. But Borris gleefully persisted.

parting gift

I was convinced that this was not merely a circus beast repeating a learned performance, or a wild animal exhibiting abnormal behavior; this animal, whatever it was, this being, this force, was the physical avatar of malevolence. It tormented me with an order of precision, ferocity, and intelligence that few humans could match. It wanted me to suffer, and suffer I did. I could see Borris’ eyes laughing at me as I vomited.

Posted in ☢⌈¥ •á☩¾ | Tagged | Leave a comment

Desired Access: Maximum Allowed

23:52.9 shower.exe 3230 NAME NOT FOUND

friendly-policeman

We’re fractured, together and apart. How smooth, how soft. How lovely. Kick the bucket. Is it ready? I’ve been waiting for so long. A marathon never ending. The tape is flipped again and again. Not put to rest. The case is not coming for a long while longer. Shelved once inefficient. Never called again.

Posted in ★â⇔∉☪〉w☍ | Tagged | Leave a comment

A Night In Honduras

TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

the big finale

blunderfailurefaultflawglitchinaccuracylapsemiscalculationmiscuemisdeedmismanagementmisstepmisunderstandingoffenseomissionsintransgressionwrongdoingabsurditybonerbooboodelinquencydelusiondeviationerratumfallfallacyfalsehoodfalsitygoofhowlermisapprehensionmisconceptionmissoversightscreamerslightslipsolecismstumbletrespassuntruthXbad jobfaux pasmisbeliefmisjudgmentscrew-upslipup

Posted in ★â⇔∉☪〉w☍ | Tagged | Leave a comment

gorilla in the mist

The souls of this founding couple’s children inhabited other places in the valley. Ritualists disagreed as to the sex of these children; some claimed, for instance, that the eldest was female, others that it was male. As spirits, however, all were double gendered, a spousal pair, bound together in permanent conjugal union.

speedball stint

The Bible stated that the creations between the fallen angels and the humans were an abomination before God, and had to be destroyed, thus the Great Flood. However, the lineage continued. The clock eats away at the time they have left until the return of the Nibiru with the Reptilians. The half-human half-reptilian Illuminati are hoping they have the technological armory to fight them off. Only time will tell.

Posted in ♡☭2ff℠Φκ | Tagged | Leave a comment

free day

High intensity LEDs to test the hypothesis that leeches could detect and specifically avoid near UVR (395-405 nM).

young sight

Ohhh! Big Mama really is such a personable cat… She’s really come into her own.

Posted in ★â⇔∉☪〉w☍ | Tagged | Leave a comment

June the 9th

8 months. Just 8 months. Just so. And so. He left, and the monster has been crafted. It slept, it waited for the right time to pull itself together. That time has come and passed. 8 months ago. Just so.

temporal award

The whore. The rotten whore with no name. He’s searching for the name, isn’t he? Doesn’t want secrets, doesn’t want knowledge. Carnal pleasures. Neanderthal. I saw her. I saw that whore. There is no hiding what you’ve done.

Posted in ☢⌈¥ •á☩¾ | Tagged | Leave a comment

former triumphs

This home is protected by rape.

helpful stranger

To demonstrate this, we have examined time series from the Henon system 1 of 1000 and 10,000 observations with Gaussian observational noise at signal:noise ratios of 60, 40, and 20 dB, and that introduced Pennsylvanians to the idea that passions could stir individual feeling for the greater good, rather than simply foster selfish emotions that could lead to social degeneracy.

Posted in ♡☭2ff℠Φκ | Tagged | Leave a comment

smothered her to death

that’s a good about point evolutionary give theory, and i learn believe we something can all from the use of hair bassist kiss in the by conventional meaning  we my back behind

yellow board

Glad I was watching tonight.

Moment with you I am busy preparing for our trip to Š’9æeS䯠this summer. Beautiful qVÈB Ž! Have fun in France. . .

Posted in ☢⌈¥ •á☩¾ | Tagged | Leave a comment

The Poet and the Lumberjack

Reptile Basics North Carolina # 457-459
Reptile Emporium Illinois # 117-118
Reptile Industries Florida # 334-336
Reptile Kingdom New Jersey # 6-7-8
Reptiles Addicts New York # 380-1 & 414-5
Reptiles Magazine Illinois # 11
Reptiles Express Georgia # 321-322
Reptmart Florida # 343-345

random sequence

The clash would be fantastic. The axe would swoop, the dishes would fly. There would be so much screaming. Salty, oily, buttery popped corn. Leisure made absolute. Vaguely rooting for the lumberjack; I like her skirt.

Posted in ☢⌈¥ •á☩¾ | Tagged | Leave a comment

the journey ahead

Leave? Now, why would I do that?

society of thieves

What’s in it for me?

Posted in ★â⇔∉☪〉w☍ | Tagged | Leave a comment